| Behavior | Obsolete Sample Sheet Settings | New Sample Sheet Settings |
|---|---|---|
| Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as trim. | Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA OR TrimAdapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Designate the same adapter sequence for Read 1 and Read 2 and specify the behavior as mask. | MaskAdapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterBehavior,mask |
| Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as mask. | MaskAdapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA OR MaskAdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT AND AdapterBehavior,mask |
| Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as trim. Also specify 0.5 as the adapter stringency. | Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA OR TrimAdapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterStringency, 0.5 |
| Behavior | Obsolete Sample Sheet Settings | New Sample Sheet Settings |
|---|---|---|
| Trim the first 7 bases and last 6 bases of Read 1 for a 151 x 8 x 8 x 151 run. | Read1StartFromCycle,8 Read1EndWithCycle,145 |
OverrideCycles,N7Y137N6;I8;I8;Y151 |
| Behavior | Obsolete Sample Sheet Settings | New Sample Sheet Settings |
|---|---|---|
Designate the first 8 cycles of Read 1 and Read 2 as UMIs and trim the trailing base for a 151 x 8 x 8 x 151 run. |
Read1UMIStartFromCycle,1 Read1UMILength,8 Read1StartFromCycle,10 Read2UMIStartFromCycle,1 Read2UMILength,6 Read2StartFromCycle,9 |
OverrideCycles,U8N1Y142;I8;I8;U6N2Y142 |
| Behavior | Obsolete Command Line Settings | New Sample Sheet Settings |
|---|---|---|
| Allow 1 mismatch in the i7 index sequence and 1 mismatch i5 index sequence. | --barcode-mismatches 1 OR --barcode-mismatches 1,1 |
BarcodeMismatchesIndex1, 1 AND BarcodeMismatchesIndex2, 1 |
| Allow 2 mismatches in the i7 index sequence and 2 mismatches in the i5 index sequence. | --barcode-mismatches 2 OR --barcode-mismatches 2,2 |
BarcodeMismatchesIndex1, 2 AND BarcodeMismatchesIndex2, 2 |
| Behavior | Obsolete Command Line Settings | New Sample Sheet Settings |
|---|---|---|
| Make sure that all trimmed reads are at least 10 base pairs long after adapter trimming by appending Ns to any read shorter than 10 base pairs. | --minimium-trimmed-read-length 10 |
MinimumTrimmedReadLength, 10 |
| Make sure that all trimmed reads below 5 base pairs long are masked with Ns. | --mask-short-adapter-reads, 5 |
MaskShortReads, 5 |